Prev. |  Human A to Z list >  R >  RXRG > 

NRCD Human cDNA Clone - RBd86D07

Catalog Number HKR394479
Clone Name RBd86D07
Clone info. Plasmid clone of human RXRG cDNA with SV40 promoter
Vector plasmidClick for information pGCAP10
5'-terminal sequence(1) GAGGAAGCGATGACCACTCTTGTTAGCCCAAGTTGAAGAAAGCCGGGCTGTGCCTGGGAG
Sequence, submitted(2) AB593015 link 01
 
Sequence, refered NM_006917.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) RXRG (NCBI Gene 6258) finder other clones with this gene.
Synonyms NR2B3|RXRC
Protein Name retinoid X receptor, gamma
KEGG link 01
Links

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Distribution information

Ordering Information [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR394479 RBd86D07 DNA solution

Sequence information

Restriction map is not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference

original Oshikawa, M., Full-length transcriptome analysis of human retina-derived cell lines ARPE-19 and Y79 using the vector-capping method. Invest. Ophthalmol. Vis. Sci. 52 (9): 6662-6670 (2011). PMID 21697133.

2017.04.06

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_170401.pl