Prev. |  KEGG KO K08526 > 

RIKEN DNA Bank Human Resource - RXRG

Gene ID NCBI Gene 6258 |  KEGG hsa:6258
Gene Symbol RXRG
Protein Name retinoid X receptor gamma
Synonyms NR2B3|RXRC
Ortholog resources KEGG ortholog (KEGG orthology K08526) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY091826 IRAL029J10 pOTB7 BC012063 NM_001009598

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE002353 W01A005O17 pENTR-TOPO IRAL029J10 BC012063 NM_001009598  
HGE002355 W01A005O19 pENTR-TOPO IRAL029J10 BC012063 NM_001009598  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR372178 RBd30H10 pGCAP10 NM_006917.3  
GACTCTTGTTAGCCCAAGTTGAAGAAAGCCGGGCTGTGCCTGGGAGCCGAGAGAGGCGGT
HKR386552 RBd66G08 pGCAP10 NM_006917.3  
TGGAGTCNCACGCAGCAGCCCAACCCTGAGTTAATCAAACTAGCAACAGGATCTCAAGCA
HKR394479 RBd86D07 pGCAP10 NM_006917.3  
GAGGAAGCGATGACCACTCTTGTTAGCCCAAGTTGAAGAAAGCCGGGCTGTGCCTGGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl