Prev. |  Human A to Z list >   >   > 

RBd62C04 - NRCD Human cDNA Clone

Catalog Number HKR384852
Clone Name RBd62C04
Clone info. Plasmid clone of human KLC1 cDNA with SV40 promoter
Vector(1) pGCAP10
5'-terminal sequence(2) GAGACGCCATTTTCGGCGGCGGGAGCGGCGCAGGCGGCCGAGCGGGACTGGCTGGGTCGG
Sequence, submitted(3) n.a.
Note match to NM_001394839.1 (1-2531) CDS:OK
 
Sequence, refered NM_005552.4 (NCBI RefSeq mRNA)
Gene Symbol and ID(4)  (NCBI Gene 3831)  other clone of in our bank
Protein Name
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR384852 RBd62C04 DNA solution

How to cite this biological resource

Materials & Methods section:

The RBd62C04 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR384852).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File
(Insert 5')
Seq File
(Insert 3')
Seq File
(Upstream of poly(A))
Seq File
(contig)
PDF File
RBd62C04a.seq     RBd62C04z.seq RBd62C04.pdf

References and tips

Featured content

Reference


2023.06.15

NRCDhumcloneList_RB_2023May03.csv - DataSheet_NRCD_html_230606.pl