DNA Bank Top |  KEGG KO K10407 > 

RIKEN DNA Bank Human Resource - KLC1

Gene ID NCBI Gene 3831 |  KEGG hsa:3831
Gene Symbol KLC1
Protein Name kinesin light chain 1
Synonyms KLC|KNS2|KNS2A

Link

Ortholog resource in our bank

  KLC1


External database

human KLC1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB04975 SEREX clone NGO-Pr-122 (ID 2289) #1 SEREX clone NGO-Pr-122 (ID 2289) #1    
RDB03841 SEREX clone NGO-St-051 (ID 332) #1 SEREX clone NGO-St-051 (ID 332) #1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY090749 IRAL026O13 pOTB7 BC008881 NM_005552.5 full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099225 M01C048B01 pDONR221 MGC13-G01 BC008881 NM_005552  
HGE099273 M01C048D01 pDONR221 MGC13-G01 BC008881 NM_005552  
HGE099321 M01C048F01 pDONR221 MGC13-G01 BC008881 NM_005552  
HGE099369 M01C048H01 pDONR221 MGC13-G01 BC008881 NM_005552  
HGE099417 M01C048J01 pDONR221 MGC13-G01 BC008881 NM_005552  
HGE099465 M01C048L01 pDONR221 MGC13-G01 BC008881 NM_005552  
HGE099513 M01C048N01 pDONR221 MGC13-G01 BC008881 NM_005552  
HGE099561 M01C048P01 pDONR221 MGC13-G01 BC008881 NM_005552  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR384852 RBd62C04 pGCAP10 NM_001394839.1 Full done
GAGACGCCATTTTCGGCGGCGGGAGCGGCGCAGGCGGCCGAGCGGGACTGGCTGGGTCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl