RBd35D12 NRCD Human cDNA Clone

Prev. | Human A to Z list > > >

RBd35D12 - NRCD Human cDNA Clone


Catalog Number	HKR374084
Clone Name	RBd35D12
Clone info.	Plasmid clone of human PLCG1 cDNA with SV40 promoter
Vector⁽¹⁾	pGCAP10
5'-terminal sequence⁽²⁾	GGAGGGCGCGCGGAGGACCCGCCGCCGCCGGTGTGAGGCGGCCCGTCCTGGCTCCCTTGT
Sequence, submitted⁽³⁾	n.a.
Note	match to NM_002660.3 (1-4627, 2751-2799 del) CDS:full/var/fs
Sequence, refered	NM_002660.2 (NCBI RefSeq mRNA)
Gene Symbol and ID⁽⁴⁾	(NCBI Gene 5335) other clone of in our bank
Protein Name

Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer Vector Backbone at NRCD Human cDNA Clone HP.
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog #	Clone name	Shipping form	Fee (non-profit org.)
HKR374084	RBd35D12	DNA solution

How to cite this biological resource

Materials & Methods section:

The RBd35D12 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR374084).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File (Insert 5')	Seq File (Insert 3')	Seq File (Upstream of poly(A))	Seq File (contig)	PDF File
RBd35D12a.seq		RBd35D12c.seq	RBd35D12z.seq	RBd35D12.pdf