Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PLCG1

Gene ID (NCBI) 5335
Gene Symbol PLCG1
Protein Name phospholipase C gamma 1
Synonyms NCKAP3|PLC-II|PLC1|PLC148|PLCgamma1
Databases KEGG hsa:5335 |  NCBI Gene 5335
Featured content NF-kappa B signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content HIF-1 signaling pathway - human
Featured content Axon guidance - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K01116)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR374084 RBd35D12 pGCAP10 NM_002660.2  
GGAGGGCGCGCGGAGGACCCGCCGCCGCCGGTGTGAGGCGGCCCGTCCTGGCTCCCTTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl