RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - PLCG1

Gene ID	NCBI Gene 5335 \| KEGG hsa:5335
Gene Symbol	PLCG1
Protein Name	phospholipase C gamma 1
Synonyms	NCKAP3\|PLC-II\|PLC1\|PLC148\|PLCgamma1
Featured content	NF-kappa B signaling pathway (human)
Featured content	T cell receptor signaling pathway (human)
Featured content	HIF-1 signaling pathway - human
Featured content	Axon guidance - human
Featured content	SARS-CoV-2 relevant human genes

Ortholog resource in our bank

  PLCG1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR374084	RBd35D12	pGCAP10	NM_002660.2
HKR374084	GGAGGGCGCGCGGAGGACCCGCCGCCGCCGGTGTGAGGCGGCCCGTCCTGGCTCCCTTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl