RBd27D07 - NRCD Human cDNA Clone

Catalog Number HKR370879 Clone Name RBd27D07 Clone info. Plasmid clone of human CNNM1 cDNA with SV40 promoter Vector(1) pGCAP10 5'-terminal sequence(2) GGCAGTATCACGTGCAGCTGCGCTGGGTGCAGGATGGCGGCGGCCGCGGCGGCGGCAGCA Sequence, submitted(3) n.a. Note match to NM_020348.3 (1-5623) except some difference.   Sequence, refered NM_020348.2 (NCBI RefSeq mRNA) Gene Symbol and ID(4) CNNM1 (NCBI Gene 26507)  other clone of CNNM1 in our bank Synonyms ACDP1|CLP-1 Protein Name cyclin and CBS domain divalent metal cation transport mediator 1

Links   KEGG   NCBI Gene   NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

How to cite this biological resource

Materials & Methods section:

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

References and tips

Featured content

Reference

2023.07.07