Prev. |  KEGG KO K16302 > 

RIKEN DNA Bank Human Resource - CNNM1

Gene ID NCBI Gene 26507 |  KEGG hsa:26507
Gene Symbol CNNM1
Protein Name cyclin and CBS domain divalent metal cation transport mediator 1
Synonyms ACDP1|CLP-1
Ortholog resource in our bank

  CNNM1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR370879 RBd27D07 pGCAP10 NM_020348.2 done
GGCAGTATCACGTGCAGCTGCGCTGGGTGCAGGATGGCGGCGGCCGCGGCGGCGGCAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl