Prev. |  Human A to Z list >  R >  RPL19 > 

RBb71B01 - NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog Number HKR348425
Clone Name RBb71B01
Clone info. Plasmid clone of human RPL19 cDNA with SV40 promoter
Vector Click for information pGCAP1
5'-terminal sequence(1) GCTTTCCTTTCGCTGCTGCGGCCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTCG
Sequence, submitted(2) n.a.
 
Sequence, refered NM_000981.3 (NCBI RefSeq mRNA)
Gene Symbol and ID(3) RPL19 (NCBI Gene 6143)  other clone of RPL19 in our bank
Synonyms L19
Protein Name ribosomal protein L19
Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) 5' terminal sequence of insert provided by the depositor.
(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(3) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Catalog # Clone name Shipping form Fee (non-profit org.)
HKR348425 RBb71B01 DNA solution

Sequence information

Full length sequence and restriction map are not available.

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

Featured content

Reference


2018.12.05

NRCDhumcloneList_RB_160109.csv - GNP_filter3_NRCD_html_181121.pl