RBb11E10 NRCD Human cDNA Clone

Prev. | Human A to Z list > B > BPHL >

RBb11E10 - NRCD Human cDNA Clone


Catalog Number	HKR324506
Clone Name	RBb11E10
Clone info.	Plasmid clone of human BPHL cDNA with SV40 promoter
Vector⁽¹⁾	pKA1U5
5'-terminal sequence⁽²⁾	GCGCATGCGCGCTCCCGGCAGCTACGCGACCTGCTGACCATGGNTGGCTGTGCTGGGCGG
Sequence, submitted⁽³⁾	n.a.
Sequence, refered	NM_004332.1 (NCBI RefSeq mRNA)
Gene Symbol and ID⁽⁴⁾	BPHL (NCBI Gene 670) other clone of BPHL in our bank
Synonyms	BPH-RP\|MCNAA\|VACVASE
Protein Name	biphenyl hydrolase like

Links

  KEGG

  NCBI Gene

  NCBI RefSeq

(1) Please refer below or Vector Backbone at NRCD Human cDNA Clone HP.
pKA1U5 (accession no. AB191256 (map of pKA1U5)
pGCAP1 (accession no. AB191257 (map of pGCAP1)
pGCAP10 (accession no. AB371573 (map of pGCAP10)
(2) 5' terminal sequence of insert provided by the depositor.
(3) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).
(4) Gene ID was determined by the 5' terminal sequence by the depositor.

Please note that the information was bioinformatically annotated and that this information may not reflect the most recent annotation of the reference sequence. You should carefully check the insert sequence provided by us to make sure that it matches the sequence you expect.

Distribution information

Plasmid request [in Japanese] [in English]

Catalog #	Clone name	Shipping form	Fee (non-profit org.)
HKR324506	RBb11E10	DNA solution

How to cite this biological resource

Materials & Methods section:

The RBb11E10 was provided by the RIKEN BRC through the National BioResource Project of the MEXT, Japan (cat. HKR324506).

Sequence information

Full length sequence and restriction map are not available.

This clone has been sequenced a portion and digested by restriction enzyme for verification. Results are available as below!

Seq File (Insert 5')	Seq File (Insert 3')	Seq File (Upstream of poly(A))	Seq File (contig)	PDF File
RBb11E10a.seq		RBb11E10c.seq	RBb11E10z.seq	RBb11E10.pdf