Prev. |  KEGG KO K18399 > 

RIKEN DNA Bank Human Resource - BPHL

Gene ID NCBI Gene 670 |  KEGG hsa:670
Gene Symbol BPHL
Protein Name biphenyl hydrolase like
Synonyms BPH-RP|MCNAA|VACVASE
Ortholog resources KEGG ortholog (KEGG orthology K18399) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR324506 RBb11E10 pKA1U5 NM_004332.1  
GCGCATGCGCGCTCCCGGCAGCTACGCGACCTGCTGACCATGGNTGGCTGTGCTGGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl