Prev. | Human A to Z list > B > 

RIKEN DNA Bank Human Resource - BPHL

Gene ID (NCBI) 670
Gene Symbol BPHL
Protein Name biphenyl hydrolase like
Synonyms BPH-RP|MCNAA|VACVASE
Databases KEGG hsa:670 |  NCBI Gene 670
Featured content Ortholog resources in the DNA Bank (KEGG orthology K18399)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR324506 RBb11E10 pKA1U5 NM_004332.1  
GCGCATGCGCGCTCCCGGCAGCTACGCGACCTGCTGACCATGGNTGGCTGTGCTGGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl