Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10916

HP ID(1) HP10916
Gene ID(2) 9743
Gene Symbol finder RICS
Protein Name Rho GTPase-activating protein
RefSeq NM_014715.2
Length of RefSeq (bp) 6480
Chromosome 11q24-q25
Reference DDBJ accession
UniGene Hs.440379

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd51F08 pGCAP10 GGAGAGAGGAGGATTAAGCTCCTGGAGGCAGAGCTCTCCCACACACTTGCTGGCTTGCTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl