Prev. |  KEGG KO K20647 > 

RIKEN DNA Bank Human Resource - ARHGAP32

Gene ID NCBI Gene 9743 |  KEGG hsa:9743
Gene Symbol ARHGAP32
Protein Name Rho GTPase activating protein 32
Synonyms GC-GAP|GRIT|PX-RICS|RICS|p200RhoGAP|p250GAP
Ortholog resources KEGG ortholog (KEGG orthology K20647) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX039201 IRAK098A01 pCMV-SPORT6 BC054488 NM_014715 Partial/var
HGY095905 IRAL039M17 pOTB7 BC023644 NM_014715 Partial/var
HGY098947 IRAL047G03 pOTB7 BC051236 NM_014715 Partial/var
HGY100278 IRAL050L14 pOTB7 BC065371 NM_014715 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR380528 RBd51F08 pGCAP10 NM_014715.2  
GGAGAGAGGAGGATTAAGCTCCTGGAGGCAGAGCTCTCCCACACACTTGCTGGCTTGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl