Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10858

HP ID(1) HP10858
Gene ID(2)
Gene Symbol finder RGS7BP(exon 1, antisense)
Protein Name
RefSeq
Length of RefSeq (bp)
Chromosome 5q12.3
Reference DDBJ accession
UniGene

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe18C05 pKA1U5 AB371474 GGCTCTCGGAGCCGCTGCCCCTGCGCTCCCAATCTCCGCTCTGCAGCGGGGGCTTGCTGA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl