Prev. |  Human A to Z list >   >   > 

NRCD Human cDNA Clone - ARe18C05

Ordering information ordering information
Catalog Number HKR047253
Clone Name ARe18C05
Vector plasmidClick for information pKA1U5
Description Plasmid clone of human RGS7BP(exon 1, antisense) cDNA with SV40 promoter
5'-terminal sequence(1) GGCTCTCGGAGCCGCTGCCCCTGCGCTCCCAATCTCCGCTCTGCAGCGGGGGCTTGCTGA
Sequence, submitted(2) AB371474 link 01
 
HP ID HP10858  finder other clones in this HP group.
Sequence, refered
Gene ID
Gene Symbol   finder other clones with this gene.
Protein Name
KEGG link 01
Links

Restriction map is not available.

(1) 5' terminal sequence of insert provided by the depositor.

(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips


2017.02.23

NRCDhumcloneList_AR_160109.csv - GNP_filter3_NRCD_html_160109.pl