NRCD Human cDNA Clone - ARe18C05

Ordering information

Catalog Number HKR047253 Clone Name ARe18C05 Vector Click for information pKA1U5 Description Plasmid clone of human RGS7BP(exon 1, antisense) cDNA with SV40 promoter 5'-terminal sequence(1) GGCTCTCGGAGCCGCTGCCCCTGCGCTCCCAATCTCCGCTCTGCAGCGGGGGCTTGCTGA Sequence, submitted(2) AB371474   HP ID HP10858   other clones in this HP group. Sequence, refered Gene ID Gene Symbol    other clones with this gene. Protein Name KEGG

Links

Restriction map is not available.

(1) 5' terminal sequence of insert provided by the depositor.

(2) Actual nucleotide sequence (could be partial) of this clone submitted to the DNA Data Bank of Japan (DDBJ).

Gene Engineering Division will sequence a portion of this resource and digest with restriction emzyme for verification before shipping.

References and tips

2017.02.23