Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10802

HP ID(1) HP10802
Gene ID(2) 113000
Gene Symbol finder RPUSD1
Protein Name RNA pseudouridylate synthase domain containing 1
RefSeq NM_058192.2
Length of RefSeq (bp) 2067
Chromosome 16p13.3
Reference DDBJ accession
UniGene Hs.101742

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi62F01 pGCAP10 CGGCCGGCCGATGCTCTGGGTCGCCAGCGCGCGGGCGCGCGGCTGGAGCCGGCGCCGGGC
RBdS075B05 pGCAP10 GCCCCNNNNNGGANCTNCNNNGGNCTNNGGGNCNCCAGCGCGCNGNNGNNTNGCTNNANC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl