Prev. | 

RIKEN DNA Bank Human Resource - RPUSD1

Gene ID NCBI Gene 113000 |  KEGG hsa:113000
Gene Symbol RPUSD1
Protein Name RNA pseudouridine synthase domain containing 1
Synonyms C16orf40|RLUCL
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005224 IRAK013A24 pCMV-SPORT6 BC012951 NM_058192
HGY091030 IRAL027J14 pOTB7 BC011783 NM_058192 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE099247 M01C048B23 pDONR221 MGC13-G12 BC011783 NM_058192  
HGE099295 M01C048D23 pDONR221 MGC13-G12 BC011783 NM_058192  
HGE099343 M01C048F23 pDONR221 MGC13-G12 BC011783 NM_058192  
HGE099391 M01C048H23 pDONR221 MGC13-G12 BC011783 NM_058192  
HGE099439 M01C048J23 pDONR221 MGC13-G12 BC011783 NM_058192  
HGE099487 M01C048L23 pDONR221 MGC13-G12 BC011783 NM_058192  
HGE099535 M01C048N23 pDONR221 MGC13-G12 BC011783 NM_058192  
HGE099583 M01C048P23 pDONR221 MGC13-G12 BC011783 NM_058192  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR184921 ARi62F01 pGCAP10 NM_058192.2  
CGGCCGGCCGATGCTCTGGGTCGCCAGCGCGCGGGCGCGCGGCTGGAGCCGGCGCCGGGC
HKR430029 RBdS075B05 pGCAP10 NM_058192.2  
GCCCCNNNNNGGANCTNCNNNGGNCTNNGGGNCNCCAGCGCGCNGNNGNNTNGCTNNANC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl