Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10684

HP ID(1) HP10684
Gene ID(2) 375260
Gene Symbol finder WASH2P
Protein Name WAS protein family homolog 2 pseudogene
RefSeq XR_040204.1
Length of RefSeq (bp) 3562
Chromosome 2q14.1
Reference DDBJ accession
UniGene Hs.446466

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe63B01 pKA1U5 GGGCGGGAGCTTCCGGGAGGGCGGCTCGCAGGCACCATGACTCCTGTGAGGATGCAGCAC
RBdS075A16 pGCAP10 GAGACGCAGGAAAGCGGGTCAAGGCGTAGGGCTGGAGGGCAGGGGCGGGCCCTGGGCCTG
RBdS110N20 pGCAP10 GGGGAGCTTCCGGGAGGGCGGCTCGCAGGCACCATGACTCCTGTGAGGATGCAGCACTCC
RBdS154L22 pGCAP10 GAGGCTGAGAGACGCAGGAAAGCGGGTCAAGCTGTAGGGCTGGAGGGCAGGGGCGGGCCC
RBdS177G18 pGCAP10 GGGAAGCGGCGGCGGGNGCTTCCGGGAGGGCGGCTCGCAGGCACCATGACTCCTGTGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl