Prev. | 

RIKEN DNA Bank Human Resource - WASH2P

Gene ID NCBI Gene 375260 |  KEGG hsa:375260
Gene Symbol WASH2P
Protein Name WAS protein family homolog 2 pseudogene
Synonyms FAM39B
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008067 IRAK020C19 pCMV-SPORT6 BC015400 NM_198943 Partial
HGX037370 IRAK093H02 pCMV-SPORT6 BC048328 NM_198943 Full
HGX066551 IRAK166G07 pCMV-SPORT6 BC073913 NM_198943 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR065225 ARe63B01 pKA1U5 XR_040204.1  
GGGCGGGAGCTTCCGGGAGGGCGGCTCGCAGGCACCATGACTCCTGTGAGGATGCAGCAC
HKR430016 RBdS075A16 pGCAP10 XR_040204.1  
GAGACGCAGGAAAGCGGGTCAAGGCGTAGGGCTGGAGGGCAGGGGCGGGCCCTGGGCCTG
HKR444332 RBdS110N20 pGCAP10 XR_040204.1  
GGGGAGCTTCCGGGAGGGCGGCTCGCAGGCACCATGACTCCTGTGAGGATGCAGCACTCC
HKR461886 RBdS154L22 pGCAP10 XR_040204.1  
GAGGCTGAGAGACGCAGGAAAGCGGGTCAAGCTGTAGGGCTGGAGGGCAGGGGCGGGCCC
HKR470962 RBdS177G18 pGCAP10 XR_040204.1  
GGGAAGCGGCGGCGGGNGCTTCCGGGAGGGCGGCTCGCAGGCACCATGACTCCTGTGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl