Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154L22

Clone ID RBdS154L22
HP ID HP10684
Gene ID 375260
Gene Symbol WASH2P
Protein Name WAS protein family homolog 2 pseudogene
Vector pGCAP10
Accession No. in DDBJ
RefSeq XR_040204.1
Length of RefSeq (bp) 3562
Chromosome 2q14.1
Reference DDBJ accession
UniGene Hs.446466
5'-terminal sequence GAGGCTGAGAGACGCAGGAAAGCGGGTCAAGCTGTAGGGCTGGAGGGCAGGGGCGGGCCC
2011.08.28