Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10640

HP ID(1) HP10640
Gene ID(2) 58505
Gene Symbol finder OSTC
Protein Name oligosaccharyltransferase complex subunit
RefSeq NM_021227.2
Length of RefSeq (bp) 1103
Chromosome 4q25
Reference DDBJ accession
UniGene Hs.445803

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe04D04 pKA1U5 GGAGAACGGCCCTTGCTGCCACCAACATGGAGACTTTGTACCGTGTCCCGTTCTTAGTGC
ARe28G02 pKA1U5 GCCTTGCTGCCACCAACATGGAGACTTTGTACCGCTGTCCCGNTTCTTAGTGCTCGAATG
ARe70E04 pKA1U5 GCTGTTTCCGGGAGGCGCGTGGGGCTTGAGGCCGAGAACGGCCCTTGCTGCCACCAACAT
ARe86G10 pKA1U5 GACCAACATGGNAGACTTTGTACCGTGNTCCCGNTTCTTAGTGCTCGAATGTCCCAACCT
ARi07C05 pGCAP10 GCTTGCTGCCACCAACATGGAGACTTTGTACCGTGTCCCGTTCTTAGTGCTCGAATGTCC
ARi15C11 pGCAP10 GCTTGCTGCCACCAACATGGAGACTTTGTACCGTGTCCCGTTCTTAGTGCTCGAATGTCC
RBdS083H17 pGCAP10 GCCTTGCTGCCACCAACATGGAGACTTTGTACCGTGTCCCGTTCTTAGTGCTCGAATGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl