Prev. | 

RIKEN DNA Bank Human Resource - OSTC

Gene ID NCBI Gene 58505 |  KEGG hsa:58505
Gene Symbol OSTC
Protein Name oligosaccharyltransferase complex non-catalytic subunit
Synonyms DC2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB18166 Human OSTC promoter P1 Luciferase reporter vector of human OSTC P1 promoter -301 to +19.
RDB18167 Human OSTC promoter P1M Luciferase reporter vector of human OSTC P1M promoter [P1 promoter (-301 to +19) with deletion (-207 to -213)].
RDB18168 Human OSTC promoter P1DM Luciferase reporter vector of human OSTC P1DM promoter [P1 promoter (-301 to +19) with deletion (-23 to -28)].

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY093081 IRAL032L17 pDNR-LIB BC016321 NM_021227 Full
HGY099221 IRAL048A21 pDNR-LIB BC054857 NM_021227 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041676 ARe04D04 pKA1U5 NM_021227.2  
GGAGAACGGCCCTTGCTGCCACCAACATGGAGACTTTGTACCGTGTCCCGTTCTTAGTGC
HKR051346 ARe28G02 pKA1U5 NM_021227.2  
GCCTTGCTGCCACCAACATGGAGACTTTGTACCGCTGTCCCGNTTCTTAGTGCTCGAATG
HKR068100 ARe70E04 pKA1U5 NM_021227.2  
GCTGTTTCCGGGAGGCGCGTGGGGCTTGAGGCCGAGAACGGCCCTTGCTGCCACCAACAT
HKR074554 ARe86G10 pKA1U5 NM_021227.2  
GACCAACATGGNAGACTTTGTACCGTGNTCCCGNTTCTTAGTGCTCGAATGTCCCAACCT
HKR162853 ARi07C05 pGCAP10 NM_021227.2  
GCTTGCTGCCACCAACATGGAGACTTTGTACCGTGTCCCGTTCTTAGTGCTCGAATGTCC
HKR166059 ARi15C11 pGCAP10 NM_021227.2  
GCTTGCTGCCACCAACATGGAGACTTTGTACCGTGTCCCGTTCTTAGTGCTCGAATGTCC
HKR433385 RBdS083H17 pGCAP10 NM_021227.2  
GCCTTGCTGCCACCAACATGGAGACTTTGTACCGTGTCCCGTTCTTAGTGCTCGAATGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.10.11

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl