Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083H17

Clone ID RBdS083H17
HP ID HP10640
Gene ID 58505
Gene Symbol OSTC
Protein Name oligosaccharyltransferase complex subunit
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_021227.2
Length of RefSeq (bp) 1103
Chromosome 4q25
Reference DDBJ accession
UniGene Hs.445803
5'-terminal sequence GCCTTGCTGCCACCAACATGGAGACTTTGTACCGTGTCCCGTTCTTAGTGCTCGAATGTC
2011.08.28