Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10599

HP ID(1) HP10599
Gene ID(2) 746
Gene Symbol finder C11orf10
Protein Name chromosome 11 open reading frame 10
RefSeq NM_014206.3
Length of RefSeq (bp) 420
Chromosome 11q12-q13.1
Reference DDBJ accession
UniGene Hs.437779

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe08H07 pKA1U5 GCTTCCGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATG
ARe40D12 pKA1U5 GTGGCCTCCGGGTTAGGCTGAGCCTCTTGCTTGCTGTGACTGGTGGAGCTGCCGCGCTGT
ARf02D04 pKA1U5 GGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATGAGCAGATA
ARi10F05 pGCAP10 GGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATGAGCAGATATAC
ARi51C10 pGCAP10 GCTTCTTCCGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCC
ARi63E12 pGCAP10 GGCCGACGTGTTCTTCCGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGC
ARiS045E05 pGCAP10 GGTTCTTCCGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCC
ARiS087N17 pGCAP10
RBd08D02 pGCAP10 GGTGTTCTTCCGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGG
RBd36H11 pGCAP10 GCCGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATGAGC
RBd66G02 pGCAP10 GGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATGAGCAG
RBd85C11 pGCAP10 GGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATGAGCAGATA
RBdS015B09 pGCAP10 GGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATGAGCAGATA
RBdS110D15 pGCAP10 GAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATGAGCAGATATACCA
RBdS132C14 pGCAP10 GCTTCCGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATG
RBdS132I17 pGCAP10 GGTTCCGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATG
RBdS154B14 pGCAP10 GGTTCTTCCGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCC
RBdS177N02 pGCAP10 GGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATGAGCAGATATACCAGCCCAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl