Prev. | 

RIKEN DNA Bank Human Resource - TMEM258

Gene ID NCBI Gene 746 |  KEGG hsa:746
Gene Symbol TMEM258
Protein Name transmembrane protein 258
Synonyms C11orf10|Kud|Kuduk
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085064 IRAL012K24 pOTB7 BC002750 NM_014206 Full
HGY093102 IRAL032M14 pDNR-LIB BC015968 NM_014206 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE098401 M01C046A01 pDONR221 MGC12-E01 BC002750 NM_014206  
HGE098449 M01C046C01 pDONR221 MGC12-E01 BC002750 NM_014206  
HGE098497 M01C046E01 pDONR221 MGC12-E01 BC002750 NM_014206  
HGE098545 M01C046G01 pDONR221 MGC12-E01 BC002750 NM_014206  
HGE098593 M01C046I01 pDONR221 MGC12-E01 BC002750 NM_014206  
HGE098641 M01C046K01 pDONR221 MGC12-E01 BC002750 NM_014206  
HGE098689 M01C046M01 pDONR221 MGC12-E01 BC002750 NM_014206  
HGE098737 M01C046O01 pDONR221 MGC12-E01 BC002750 NM_014206  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_210404.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043375 ARe08H07 pKA1U5 NM_014206.3  
GCTTCCGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATG
HKR056084 ARe40D12 pKA1U5 NM_014206.3  
GTGGCCTCCGGGTTAGGCTGAGCCTCTTGCTTGCTGTGACTGGTGGAGCTGCCGCGCTGT
HKR080876 ARf02D04 pKA1U5 NM_014206.3  
GGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATGAGCAGATA
HKR164125 ARi10F05 pGCAP10 NM_014206.3  
GGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATGAGCAGATATAC
HKR180458 ARi51C10 pGCAP10 NM_014206.3  
GCTTCTTCCGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCC
HKR185308 ARi63E12 pGCAP10 NM_014206.3  
GGCCGACGTGTTCTTCCGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGC
HKR218101 ARiS045E05 pGCAP10 NM_014206.3  
GGTTCTTCCGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCC
HKR235129 ARiS087N17 pGCAP10 NM_014206.3  
HKR363274 RBd08D02 pGCAP10 NM_014206.3  
GGTGTTCTTCCGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGG
HKR374579 RBd36H11 pGCAP10 NM_014206.3  
GCCGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATGAGC
HKR386546 RBd66G02 pGCAP10 NM_014206.3  
GGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATGAGCAG
HKR394059 RBd85C11 pGCAP10 NM_014206.3  
GGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATGAGCAGATA
HKR406033 RBdS015B09 pGCAP10 NM_014206.3  
GGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATGAGCAGATA
HKR444087 RBdS110D15 pGCAP10 NM_014206.3  
GAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATGAGCAGATATACCA
HKR452862 RBdS132C14 pGCAP10 NM_014206.3  
GCTTCCGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATG
HKR453009 RBdS132I17 pGCAP10 NM_014206.3  
GGTTCCGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATG
HKR461638 RBdS154B14 pGCAP10 NM_014206.3  
GGTTCTTCCGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCC
HKR471114 RBdS177N02 pGCAP10 NM_014206.3  
GGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCCATGAGCAGATATACCAGCCCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl