Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS154B14

Clone ID RBdS154B14
HP ID HP10599
Gene ID 746
Gene Symbol C11orf10
Protein Name chromosome 11 open reading frame 10
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014206.3
Length of RefSeq (bp) 420
Chromosome 11q12-q13.1
Reference DDBJ accession
UniGene Hs.437779
5'-terminal sequence GGTTCTTCCGGTGGCGGAGCGGCGGATTAGCCTTCGCGGGGCAAAATGGAGCTCGAGGCC
2011.08.28