Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10563

HP ID(1) HP10563
Gene ID(2) 29058
Gene Symbol finder C20orf30
Protein Name chromosome 20 open reading frame 30
RefSeq NM_014145.4
Length of RefSeq (bp) 1699
Chromosome 20p13
Reference DDBJ accession
UniGene Hs.719105

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe03F09 pKA1U5 GGCCGGCTGAGTGGCACTTAAGCGGGCCATGCCATGCAACCTTGGGCGCTGCCAACCGTG
ARe06E04 pKA1U5 GGGGGACAGAACCGNTCCTCTCGGGCTCTGGGCNTGTCCNAGACCGCGCTCCCCGCCGAA
ARe39C07 pKA1U5 GATCCGTGTGGGGCATTCGTCCCCCCTGGCACAGATTGGCCTCATTTCCAGAAGCCCGTT
ARi29G05 pGCAP10 GACTGATCCCGCCTGGGGCCGGCTGAGTGGCACTTAAGCGGGCCATGCCATGCAACCTTG
RBb39C10 pGCAP1 GGGGCCATGCCATGCAACCTTGGGCGCTGCCAACCGTGGGCGAGCTCTGGGTGTGCGGGC
RBd30H06 pGCAP10 CGGCCGGCCGATGGCCTGGGGCCGGCTGAGTGGCACTTAAGCGGGCCATGCCATGCAACC
RBd90E11 pGCAP10 GATCCCGCCTGGGGCCGGCTGAGTGGCACTTAAGCGGGCCATGCCATGCAACCTTGGGCG
RBdS014J13 pGCAP10 TGGACTTCCGGCGCACTGATCCCGCCTGGGGCCGGCTGAGTGGCACTTAAGCGGGCCATG
RBdS022K21 pGCAP10 GGGCTGAGTGGCACTTAAGCGGGCCATGCCATGCAACCTTGGGCGCTGCCAACCGTGGGC
RBdS187G22 pGCAP10 GACTGATCCCGCCTGGGGCCGGCTGAGTGGCACTTAAGCGGGCCATGCCATGCAACCTTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl