Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS187G22

Clone ID RBdS187G22
HP ID HP10563
Gene ID 29058
Gene Symbol C20orf30
Protein Name chromosome 20 open reading frame 30
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_014145.4
Length of RefSeq (bp) 1699
Chromosome 20p13
Reference DDBJ accession
UniGene Hs.719105
5'-terminal sequence GACTGATCCCGCCTGGGGCCGGCTGAGTGGCACTTAAGCGGGCCATGCCATGCAACCTTG
2011.08.28