Prev. | 

RIKEN DNA Bank Human Resource - TMEM230

Gene ID NCBI Gene 29058 |  KEGG hsa:29058
Gene Symbol TMEM230
Protein Name transmembrane protein 230
Synonyms C20orf30|HSPC274|dJ1116H23.2.1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008430 IRAK021B06 pCMV-SPORT6 BC011990 NM_014145 Full/var
HGY087697 IRAL019E01 pDNR-LIB BC009768 NM_014145 Full
HGY087747 IRAL019G03 pDNR-LIB BC009769 NM_014145 Full
HGY087770 IRAL019H02 pDNR-LIB BC009770 NM_014145 Full
HGY092748 IRAL031O12 pDNR-LIB BC015113 NM_014145 Full
HGY102944 IRAL057F24 pDNR-LIB BC070212 NM_014145 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041329 ARe03F09 pKA1U5 NM_014145.4  
GGCCGGCTGAGTGGCACTTAAGCGGGCCATGCCATGCAACCTTGGGCGCTGCCAACCGTG
HKR042500 ARe06E04 pKA1U5 NM_014145.4  
GGGGGACAGAACCGNTCCTCTCGGGCTCTGGGCNTGTCCNAGACCGCGCTCCCCGCCGAA
HKR055655 ARe39C07 pKA1U5 NM_014145.4  
GATCCGTGTGGGGCATTCGTCCCCCCTGGCACAGATTGGCCTCATTTCCAGAAGCCCGTT
HKR171749 ARi29G05 pGCAP10 NM_014145.4  
GACTGATCCCGCCTGGGGCCGGCTGAGTGGCACTTAAGCGGGCCATGCCATGCAACCTTG
HKR335658 RBb39C10 pGCAP1 NM_014145.4  
GGGGCCATGCCATGCAACCTTGGGCGCTGCCAACCGTGGGCGAGCTCTGGGTGTGCGGGC
HKR372174 RBd30H06 pGCAP10 NM_014145.4  
CGGCCGGCCGATGGCCTGGGGCCGGCTGAGTGGCACTTAAGCGGGCCATGCCATGCAACC
HKR396107 RBd90E11 pGCAP10 NM_014145.4  
GATCCCGCCTGGGGCCGGCTGAGTGGCACTTAAGCGGGCCATGCCATGCAACCTTGGGCG
HKR405829 RBdS014J13 pGCAP10 NM_014145.4  
TGGACTTCCGGCGCACTGATCCCGCCTGGGGCCGGCTGAGTGGCACTTAAGCGGGCCATG
HKR409061 RBdS022K21 pGCAP10 NM_014145.4  
GGGCTGAGTGGCACTTAAGCGGGCCATGCCATGCAACCTTGGGCGCTGCCAACCGTGGGC
HKR474966 RBdS187G22 pGCAP10 NM_014145.4  
GACTGATCCCGCCTGGGGCCGGCTGAGTGGCACTTAAGCGGGCCATGCCATGCAACCTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.20

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl