Prev. | NRCD Clone O | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10552

HP ID(1) HP10552
Gene ID(2) 54940
Gene Symbol finder OCIAD1
Protein Name OCIA domain containing 1
RefSeq NM_017830.1
Length of RefSeq (bp) 1434
Chromosome 4p11
Reference DDBJ accession
UniGene Hs.518750

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe57F07 pKA1U5 GGAGCCCCTGNTCTGGATGACTTCTTGCGGCTGCTTCTACCCCTCCCCCTCCCCGCGGTA
ARi08F09 pGCAP10 GTTCTTGCGGCTGTTCTACCCCTCCCCCTCCCCGCGGTACCTTGCACTTTTCTCCCTCCC
ARi48F05 pGCAP10 GCTGTCTGGATGACTTCTTGCGGCTGTTCTACCCCTCCCCCTCCCCGCGGTACCTTGCAC
ARiS118N24 pGCAP10 GGAGCCCCTGTCTGGATGACTTCTTGCGGCTGTTCTACCCCTCCCCCTCCCCGCGGNACC
RBd32F11 pGCAP10 GGCTGGCTCTCAGACCCGCAGTGAGGTCTGACGTCATTTCCTGCCTCGCCTGCTGCTGTC
RBd52F04 pGCAP10 GCTCTCGAGTCCACCCTCCGGGCCTTCTGCCCCTGATCGCTTGGTTTTCCTTGCAGTCGC
RBdS022O16 pGCAP10 GGAGTGCCGGTGACTGCGGGAGGCGACGGAGTGCTTCTGGGGGTGTGAGCTGGGGAAGTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl