Prev. | 

RIKEN DNA Bank Human Resource - OCIAD1

Gene ID NCBI Gene 54940 |  KEGG hsa:54940
Gene Symbol OCIAD1
Protein Name OCIA domain containing 1
Synonyms ASRIJ|OCIA|TPA018
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001242 IRAK003B18 pCMV-SPORT6 BC003409 NM_017830 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR062927 ARe57F07 pKA1U5 NM_017830.1  
GGAGCCCCTGNTCTGGATGACTTCTTGCGGCTGCTTCTACCCCTCCCCCTCCCCGCGGTA
HKR163329 ARi08F09 pGCAP10 NM_017830.1  
GTTCTTGCGGCTGTTCTACCCCTCCCCCTCCCCGCGGTACCTTGCACTTTTCTCCCTCCC
HKR179325 ARi48F05 pGCAP10 NM_017830.1  
GCTGTCTGGATGACTTCTTGCGGCTGTTCTACCCCTCCCCCTCCCCGCGGTACCTTGCAC
HKR247536 ARiS118N24 pGCAP10 NM_017830.1  
GGAGCCCCTGTCTGGATGACTTCTTGCGGCTGTTCTACCCCTCCCCCTCCCCGCGGNACC
HKR372931 RBd32F11 pGCAP10 NM_017830.1  
GGCTGGCTCTCAGACCCGCAGTGAGGTCTGACGTCATTTCCTGCCTCGCCTGCTGCTGTC
HKR380924 RBd52F04 pGCAP10 NM_017830.1  
GCTCTCGAGTCCACCCTCCGGGCCTTCTGCCCCTGATCGCTTGGTTTTCCTTGCAGTCGC
HKR409152 RBdS022O16 pGCAP10 NM_017830.1  
GGAGTGCCGGTGACTGCGGGAGGCGACGGAGTGCTTCTGGGGGTGTGAGCTGGGGAAGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl