Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS022O16

Clone ID RBdS022O16
HP ID HP10552
Gene ID 54940
Gene Symbol OCIAD1
Protein Name OCIA domain containing 1
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_017830.1
Length of RefSeq (bp) 1434
Chromosome 4p11
Reference DDBJ accession
UniGene Hs.518750
5'-terminal sequence GGAGTGCCGGTGACTGCGGGAGGCGACGGAGTGCTTCTGGGGGTGTGAGCTGGGGAAGTT
2011.08.28