Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10540

HP ID(1) HP10540
Gene ID(2) 440400
Gene Symbol finder RNASEK
Protein Name ribonuclease, RNase K
RefSeq NM_001004333.3
Length of RefSeq (bp) 755
Chromosome 17p13.1
Reference DDBJ accession
UniGene Hs.632232

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe09D02 pKA1U5 GGCTTGCACCTCGGCGATCCCCGACTCCCTTCTTTATGGCGTCGCTCCTGTGCTGTGGGC
ARe55C06 pKA1U5 GGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTCTTTATGGCGTCGCTC
ARe96F11 pKA1U5 GATCCTGGGCTTTCTCCCACCGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTC
ARi15H10 pGCAP10 GATCCTGGGCTTTCTCCCACCGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTC
ARi41E09 pGCAP10 GGGGCTTTCTCCCACCGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTC
ARi62E09 pGCAP10 GGCTTTCTCCCACCGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTCTT
ARi63G05 pGCAP10 GGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTCTTTATGGCGTCGCTC
ARiS020N05 pGCAP10 GGGGCTTTCTCCCACCGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTC
ARiS191F12 pGCAP10 NGGCCGGGCNATNTCCNGTGGNNNTTTTTTTTTTTTTTGCNCCTTTTTNATCCCNNACTC
RBb31E04 pGCAP1
RBb68B07 pGCAP1 GCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTCTTTATGGCGTCGCTCCTGTGCTGTG
RBd05H11 pGCAP10 GATCCTGGGCTTTCTCCCACCGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTC
RBd09E04 pGCAP10 TGGGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTCTTTATGGCGTCGC
RBd80A05 pGCAP10 GACCGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTCTTTATGGCGTCG
RBd85H04 pGCAP10 GCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTCTTTATGGCGTCGCTCCTGTGCTGTG
RBd88D03 pGCAP10 GCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTCTTTATGGCGTCGCTCCTGTGCTGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl