Prev. |  KEGG KO K19770 > 

RIKEN DNA Bank Human Resource - RNASEK

Gene ID NCBI Gene 440400 |  KEGG hsa:440400
Gene Symbol RNASEK
Protein Name ribonuclease K
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K19770) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX027699 IRAK069E03 pCMV-SPORT6 BC032510 NM_001004333 Full/var
HGX033793 IRAK084I01 pCMV-SPORT6 BC040148 NM_001004333 Full/var
HGX042822 IRAK107A22 pCMV-SPORT6 BC051802 NM_001004333 Full
HGY100540 IRAL051F20 pDNR-LIB BC062705 NM_001004333 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR043674 ARe09D02 pKA1U5 NM_001004333.3  
GGCTTGCACCTCGGCGATCCCCGACTCCCTTCTTTATGGCGTCGCTCCTGTGCTGTGGGC
HKR062054 ARe55C06 pKA1U5 NM_001004333.3  
GGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTCTTTATGGCGTCGCTC
HKR078531 ARe96F11 pKA1U5 NM_001004333.3  
GATCCTGGGCTTTCTCCCACCGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTC
HKR166178 ARi15H10 pGCAP10 NM_001004333.3  
GATCCTGGGCTTTCTCCCACCGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTC
HKR176505 ARi41E09 pGCAP10 NM_001004333.3  
GGGGCTTTCTCCCACCGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTC
HKR184905 ARi62E09 pGCAP10 NM_001004333.3  
GGCTTTCTCCCACCGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTCTT
HKR185349 ARi63G05 pGCAP10 NM_001004333.3  
GGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTCTTTATGGCGTCGCTC
HKR208317 ARiS020N05 pGCAP10 NM_001004333.3  
GGGGCTTTCTCCCACCGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTC
HKR276532 ARiS191F12 pGCAP10 NM_001004333.3  
NGGCCGGGCNATNTCCNGTGGNNNTTTTTTTTTTTTTTGCNCCTTTTTNATCCCNNACTC
HKR332500 RBb31E04 pGCAP1 NM_001004333.3  
HKR347231 RBb68B07 pGCAP1 NM_001004333.3  
GCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTCTTTATGGCGTCGCTCCTGTGCTGTG
HKR362179 RBd05H11 pGCAP10 NM_001004333.3  
GATCCTGGGCTTTCTCCCACCGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTC
HKR363700 RBd09E04 pGCAP10 NM_001004333.3  
TGGGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTCTTTATGGCGTCGC
HKR392005 RBd80A05 pGCAP10 NM_001004333.3  
GACCGCTTTCCGAGCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTCTTTATGGCGTCG
HKR394172 RBd85H04 pGCAP10 NM_001004333.3  
GCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTCTTTATGGCGTCGCTCCTGTGCTGTG
HKR395275 RBd88D03 pGCAP10 NM_001004333.3  
GCCCGCTTGCACCTCGGCGATCCCCGACTCCCTTCTTTATGGCGTCGCTCCTGTGCTGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl