Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10412

HP ID(1) HP10412
Gene ID(2) 65992
Gene Symbol finder C20orf116
Protein Name chromosome 20 open reading frame 116
RefSeq NM_023935.1
Length of RefSeq (bp) 1298
Chromosome 20p13
Reference DDBJ accession
UniGene Hs.471975

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBd66G12 pGCAP10 GGGGGCGGGGCCTATGAGATCCCGGCCTCAGGGTGGACGCAGTGGTTCTGCACTGAGGCC
RBdS081M01 pGCAP10 GACTGAGGCCCTCGTCATGGTGGCGCCTGTGTGGTACTTGGTAGCGGCGGCTCTGCTAGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl