Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS081M01

Clone ID RBdS081M01
HP ID HP10412
Gene ID 65992
Gene Symbol C20orf116
Protein Name chromosome 20 open reading frame 116
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_023935.1
Length of RefSeq (bp) 1298
Chromosome 20p13
Reference DDBJ accession
UniGene Hs.471975
5'-terminal sequence GACTGAGGCCCTCGTCATGGTGGCGCCTGTGTGGTACTTGGTAGCGGCGGCTCTGCTAGT
2011.08.28