Prev. | 

RIKEN DNA Bank Human Resource - DDRGK1

Gene ID NCBI Gene 65992 |  KEGG hsa:65992
Gene Symbol DDRGK1
Protein Name DDRGK domain containing 1
Synonyms C20orf116|SEMDSH|UFBP1|dJ1187M17.3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082185 IRAL005H17 pOTB7 BC000643 NM_023935
HGY088322 IRAL020N10 pOTB7 BC007957 NM_023935 Full/var
HGY091447 IRAL028K07 pOTB7 BC011851 NM_023935 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001491 W01A003M03 pENTR-TOPO IRAL005H17 BC000643 NM_023935  
HGE001493 W01A003M05 pENTR-TOPO IRAL005H17 BC000643 NM_023935  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR386556 RBd66G12 pGCAP10 NM_023935.1  
GGGGGCGGGGCCTATGAGATCCCGGCCTCAGGGTGGACGCAGTGGTTCTGCACTGAGGCC
HKR432689 RBdS081M01 pGCAP10 NM_023935.1  
GACTGAGGCCCTCGTCATGGTGGCGCCTGTGTGGTACTTGGTAGCGGCGGCTCTGCTAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl