Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10350

HP ID(1) HP10350
Gene ID(2) 50854
Gene Symbol finder C6orf48
Protein Name chromosome 6 open reading frame 48
RefSeq NM_001040437.1
Length of RefSeq (bp) 842
Chromosome 6p21.3
Reference DDBJ accession
UniGene Hs.640836

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe66E08 pKA1U5 GCTTTTTGCGAAGTGGGCTCGTGGGTTGGCAGTATGAGAGTTGTAATGGCCCGACTGTTG
ARi13F01 pGCAP10 GCTTTTTGCGAGTGGGCTCGGGGGTTGGCAGTATGAGAGTTGTAATGGGCCGACTGTTGA
ARi65H11 pGCAP10 GCTTTTTGCGANNGNGCTCGTGNNTTGGCAGTATGAGAGTTGTATGNCCGACTGTTGAGT
RBd03B05 pGCAP10 CGGCCGGCCGATGCTTTTTGCGAAGTGGGCTCGTGGGTTGGCAGTATGAGAGTTGTAATG
RBd44E12 pGCAP10 GCTTTTTGCGAAGTGGGCTCGTGGGTTGGCAGTATGAGAGTTGTAATGGCCCGACTGTTG
RBd64B12 pGCAP10 GCTTTTTGCGAAGTGGGCTCGTGGGTTGGCAGTATGAGAGTTGTAATGGCCCGACTGTTG
RBdS083G16 pGCAP10 GTTTTTGCGAAGTGGGCTCGTGGGTTGGCAGTATGAGAGTTGTAATGGCCCGACTGTTGA
RBdS083P09 pGCAP10 GATACCNGTCAGGCCCCCAACCCGGCGCCGCCATAAATGGCCCCGGCCTCGCCATTTTAG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl