Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS083P09

Clone ID RBdS083P09
HP ID HP10350
Gene ID 50854
Gene Symbol C6orf48
Protein Name chromosome 6 open reading frame 48
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_001040437.1
Length of RefSeq (bp) 842
Chromosome 6p21.3
Reference DDBJ accession
UniGene Hs.640836
5'-terminal sequence GATACCNGTCAGGCCCCCAACCCGGCGCCGCCATAAATGGCCCCGGCCTCGCCATTTTAG
2011.08.28