Prev. | 

RIKEN DNA Bank Human Resource - C6orf48

Gene ID NCBI Gene 50854 |  KEGG hsa:50854
Gene Symbol C6orf48
Protein Name chromosome 6 open reading frame 48
Synonyms D6S57|G8
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067014 IRAK167I22 pBluescriptR BC066330 NM_016947 Full/var
HGY088649 IRAL021K09 pDNR-LIB BC017660 NM_016947 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066504 ARe66E08 pKA1U5 NM_001040437.1  
GCTTTTTGCGAAGTGGGCTCGTGGGTTGGCAGTATGAGAGTTGTAATGGCCCGACTGTTG
HKR165321 ARi13F01 pGCAP10 NM_001040437.1  
GCTTTTTGCGAGTGGGCTCGGGGGTTGGCAGTATGAGAGTTGTAATGGGCCGACTGTTGA
HKR186179 ARi65H11 pGCAP10 NM_001040437.1  
GCTTTTTGCGANNGNGCTCGTGNNTTGGCAGTATGAGAGTTGTATGNCCGACTGTTGAGT
HKR361229 RBd03B05 pGCAP10 NM_001040437.1  
CGGCCGGCCGATGCTTTTTGCGAAGTGGGCTCGTGGGTTGGCAGTATGAGAGTTGTAATG
HKR377708 RBd44E12 pGCAP10 NM_001040437.1  
GCTTTTTGCGAAGTGGGCTCGTGGGTTGGCAGTATGAGAGTTGTAATGGCCCGACTGTTG
HKR385636 RBd64B12 pGCAP10 NM_001040437.1  
GCTTTTTGCGAAGTGGGCTCGTGGGTTGGCAGTATGAGAGTTGTAATGGCCCGACTGTTG
HKR433360 RBdS083G16 pGCAP10 NM_001040437.1  
GTTTTTGCGAAGTGGGCTCGTGGGTTGGCAGTATGAGAGTTGTAATGGCCCGACTGTTGA
HKR433569 RBdS083P09 pGCAP10 NM_001040437.1  
GATACCNGTCAGGCCCCCAACCCGGCGCCGCCATAAATGGCCCCGGCCTCGCCATTTTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl