Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10303

HP ID(1) HP10303
Gene ID(2) 441951
Gene Symbol finder C20orf199
Protein Name chromosome 20 open reading frame 199
RefSeq NR_003604.1
Length of RefSeq (bp) 564
Chromosome 20q13.13
Reference DDBJ accession
UniGene Hs.356766

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe24E02 pKA1U5 GCTTTTCTTTCGCGTCTGCGGTGCCCGGAGTGTGGTACTTCTCCTAGTTGCAGTCAGGCT
ARe50F06 pKA1U5 GCTTTCGCGCTCTGCGGTGCCCGGAGTGTGGTACTTCTCCTAGNTTGCAGTCAGGCTTCA
ARf05G05 pKA1U5 GCTTTCGCGTCTGCGGTGCTCGGAGTGTGGTACTTCTCCTAGTTGCAGTCAGGCTTCATA
ARi44E12 pGCAP10 GCTTTCGCGTCTGCGGTGCCCGGAGTGTGGTACTTCTCCTAGTTGCAGTCAGGCTTCATA
RBd03D01 pGCAP10 GATTCGTTCTTTCGCGTCTGCGGTGCTCGGAGTGTGGTACTTCTCCTAGTTGCAGTCAGG
RBd39B02 pGCAP10 GCTTTCGCGTCTGCGGTGCCCGGAGTGTGGTACTTCTCCTAGTTGCAGTCAGGCTTCATA
RBdS007H20 pGCAP10 GCTTTCGCGTCTGCGGTGCCCGGAGTGTGGTACTTCTCCTAGTTGCAGTCAGGCTTCATA
RBdS051C21 pGCAP10 GCTTTCGCGTCTGCGGTGCCCGGAGTGTGGTACTTCTCCTAGTTGCAGTCAGGCTTCATA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl