Prev. | 

RIKEN DNA Bank Human Resource - ZFAS1

Gene ID NCBI Gene 441951 |  KEGG hsa:441951
Gene Symbol ZFAS1
Protein Name ZNFX1 antisense RNA 1
Synonyms C20orf199|HSUP1|HSUP2|NCRNA00275|ZNFX1-AS1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025888 IRAK064L24 pCMV-SPORT6 BC032480 XM_945311 Partial
HGY036557 IRAK091G13 pBluescript BC042807 XM_933945 Partial
HGX053666 IRAK134C18 pCMV-SPORT6 BC060315 XM_933945 Partial
HGY100469 IRAL051C21 pDNR-LIB BC062222 XM_945311
HGY100471 IRAL051C23 pDNR-LIB BC062447 XM_945311 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR049698 ARe24E02 pKA1U5 NR_003604.1  
GCTTTTCTTTCGCGTCTGCGGTGCCCGGAGTGTGGTACTTCTCCTAGTTGCAGTCAGGCT
HKR060126 ARe50F06 pKA1U5 NR_003604.1  
GCTTTCGCGCTCTGCGGTGCCCGGAGTGTGGTACTTCTCCTAGNTTGCAGTCAGGCTTCA
HKR082149 ARf05G05 pKA1U5 NR_003604.1  
GCTTTCGCGTCTGCGGTGCTCGGAGTGTGGTACTTCTCCTAGTTGCAGTCAGGCTTCATA
HKR177708 ARi44E12 pGCAP10 NR_003604.1  
GCTTTCGCGTCTGCGGTGCCCGGAGTGTGGTACTTCTCCTAGTTGCAGTCAGGCTTCATA
HKR361273 RBd03D01 pGCAP10 NR_003604.1  
GATTCGTTCTTTCGCGTCTGCGGTGCTCGGAGTGTGGTACTTCTCCTAGTTGCAGTCAGG
HKR375626 RBd39B02 pGCAP10 NR_003604.1  
GCTTTCGCGTCTGCGGTGCCCGGAGTGTGGTACTTCTCCTAGTTGCAGTCAGGCTTCATA
HKR402988 RBdS007H20 pGCAP10 NR_003604.1  
GCTTTCGCGTCTGCGGTGCCCGGAGTGTGGTACTTCTCCTAGTTGCAGTCAGGCTTCATA
HKR420469 RBdS051C21 pGCAP10 NR_003604.1  
GCTTTCGCGTCTGCGGTGCCCGGAGTGTGGTACTTCTCCTAGTTGCAGTCAGGCTTCATA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl