Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS051C21

Clone ID RBdS051C21
HP ID HP10303
Gene ID 441951
Gene Symbol C20orf199
Protein Name chromosome 20 open reading frame 199
Vector pGCAP10
Accession No. in DDBJ
RefSeq NR_003604.1
Length of RefSeq (bp) 564
Chromosome 20q13.13
Reference DDBJ accession
UniGene Hs.356766
5'-terminal sequence GCTTTCGCGTCTGCGGTGCCCGGAGTGTGGTACTTCTCCTAGTTGCAGTCAGGCTTCATA
2011.08.28