Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP10200

HP ID(1) HP10200
Gene ID(2) 79002
Gene Symbol finder C19orf43
Protein Name chromosome 19 open reading frame 43
RefSeq NM_024038.2
Length of RefSeq (bp) 945
Chromosome 19p13.13
Reference DDBJ accession
UniGene Hs.515155

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb19E10 pKA1U5 GGCGCGGCACCTGGCGACAAAATGGCTGCCCGAGGGAGACGGGCGGAGCCTCAGGGCCGG
RBb20E12 pKA1U5 GCCTTTGCGCGGCACCTGGCGACAAAATGGCTGCCCGAGGGAGACGGGCGGAGCCTCAGG
RBd18F04 pGCAP10 GCCTTTGCGCGGCACCTGGCGACAAAATGGCTGCCCGAGGGAGACGGGCGGAGCCTCAGG
RBdS075E05 pGCAP10 GCTTTGCGCGGCACCTGGCGACAAAATGGCTGCCCGAGGGAGACGGGCGGAGCCTCAGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl