Prev. | 

RIKEN DNA Bank Human Resource - TRIR

Gene ID NCBI Gene 79002 |  KEGG hsa:79002
Gene Symbol TRIR
Protein Name telomerase RNA component interacting RNase
Synonyms C19orf43|TERCIR|fSAP18
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008066 IRAK020C18 pCMV-SPORT6 BC015347 NM_024038 Full
HGX035216 IRAK088A16 pCMV-SPORT6 BC040846 NM_024038
HGY081028 IRAL002J12 pOTB7 BC000216 NM_024038
HGY081942 IRAL004O06 pOTB7 BC004533 NM_024038 Full
HGY084273 IRAL010L09 pOTB7 BC000216 NM_024038

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR327706 RBb19E10 pKA1U5 NM_024038.2  
GGCGCGGCACCTGGCGACAAAATGGCTGCCCGAGGGAGACGGGCGGAGCCTCAGGGCCGG
HKR328108 RBb20E12 pKA1U5 NM_024038.2  
GCCTTTGCGCGGCACCTGGCGACAAAATGGCTGCCCGAGGGAGACGGGCGGAGCCTCAGG
HKR367324 RBd18F04 pGCAP10 NM_024038.2  
GCCTTTGCGCGGCACCTGGCGACAAAATGGCTGCCCGAGGGAGACGGGCGGAGCCTCAGG
HKR430101 RBdS075E05 pGCAP10 NM_024038.2  
GCTTTGCGCGGCACCTGGCGACAAAATGGCTGCCCGAGGGAGACGGGCGGAGCCTCAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl