Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS075E05

Clone ID RBdS075E05
HP ID HP10200
Gene ID 79002
Gene Symbol C19orf43
Protein Name chromosome 19 open reading frame 43
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_024038.2
Length of RefSeq (bp) 945
Chromosome 19p13.13
Reference DDBJ accession
UniGene Hs.515155
5'-terminal sequence GCTTTGCGCGGCACCTGGCGACAAAATGGCTGCCCGAGGGAGACGGGCGGAGCCTCAGGG
2011.08.28