Prev. | NRCD Clone U | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09267

HP ID(1) HP09267
Gene ID(2) 7405
Gene Symbol finder UVRAG
Protein Name UV radiation resistance associated gene
RefSeq NM_003369.3
Length of RefSeq (bp) 5166
Chromosome 11q13.5
Reference DDBJ accession
UniGene Hs.719175

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS177I05 pGCAP10 TGGGCGGTAATATGGCTCTTCCTTAGCCAGCGGCGGCAACGGCGGCAGCGGCGGCAGCGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl