Prev.
Available from Riken BioResource Center.

NRCD Human cDNA Clone - RBdS177I05

Clone ID RBdS177I05
HP ID HP09267
Gene ID 7405
Gene Symbol UVRAG
Protein Name UV radiation resistance associated gene
Vector pGCAP10
Accession No. in DDBJ
RefSeq NM_003369.3
Length of RefSeq (bp) 5166
Chromosome 11q13.5
Reference DDBJ accession
UniGene Hs.719175
5'-terminal sequence TGGGCGGTAATATGGCTCTTCCTTAGCCAGCGGCGGCAACGGCGGCAGCGGCGGCAGCGG
2011.08.28