DNA Bank Top |  KEGG KO K21249 > 

RIKEN DNA Bank Human Resource - UVRAG

Gene ID NCBI Gene 7405 |  KEGG hsa:7405
Gene Symbol UVRAG
Protein Name UV radiation resistance associated
Synonyms DHTX|VPS38|p63

Link

Ortholog resource in our bank

  UVRAG


External database

human UVRAG

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB19803 pCI-neo-HA-hUVRAG Expression vector of human UVRAG with N-terminal HA.    
RDB19776 p3xFLAG-CMV10-hUVRAG Transient expression vector of human UVRAG with N-terminal 3×FLAG.    
RDB19632 pEGFP-C1-hUVRAG Transient expression vector of human UVRAG with N-terminal EGFP.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056504 IRAK141E08 pCMV-SPORT6 BC064837 NM_003369 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR470997 RBdS177I05 pGCAP10 NM_003369.3  
TGGGCGGTAATATGGCTCTTCCTTAGCCAGCGGCGGCAACGGCGGCAGCGGCGGCAGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.10.04

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl