Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP09254

HP ID(1) HP09254
Gene ID(2) 79823
Gene Symbol finder C2orf34
Protein Name chromosome 2 open reading frame 34
RefSeq NM_024766.3
Length of RefSeq (bp) 1611
Chromosome 2p21
Reference DDBJ accession
UniGene Hs.468349

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS177A19 pGCAP10 GTCCAGTGAGATGGAGTCGCGAGTCGCGGACGCTGGGACCGGCGAGACCGCGCGAGCAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl